Define/Explain: $A$ promoter and the structural gene.
(N/A) promoter is a $DNA$ sequence that provides a binding site for $RNA$ polymerase. It is located at the $5'$ end of the structural gene.
- The structural gene in a transcription unit is the segment of $DNA$ that codes for a polypeptide or $RNA$ molecule and is flanked by a promoter and a terminator.
- The structural gene in a transcription unit is the segment of $DNA$ that codes for a polypeptide or $RNA$ molecule and is flanked by a promoter and a terminator.
Explore More
Similar Questions
If a $DNA$ strand has the base sequence $5'-AAAA-3'$,then the base sequence of the complementary $m-RNA$ is:
Medium
View SolutionThe process of synthesis of $RNA$ on a $DNA$ template is known as:
Easy
View SolutionWhich one is the correct product of $DNA$ dependent $RNA$ polymerase for the given template strand?
$3'TACATGGCAAATATCCATTCA5'$
$3'TACATGGCAAATATCCATTCA5'$
MediumNEET 2024
View SolutionThe process of removing introns and joining exons in a defined order from $RNA$ is known as.........
Easy
View SolutionGenetic information flows from ......... to ..........
Medium
View SolutionVedclass Products
For Students
Vedclass Test Series
Mock tests in real JEE/NEET style with performance analysis. 5-day free trial.
Start Free TrialFor Teachers
Exam Paper Generator
Generate Set A/B/C/D exam papers from 7.5L+ questions in 2 minutes. 3 chapters free.
Try FreeFor Institutes
Online Exam Module
Live online exams with unlimited students, 360° analytics & white-label branding.
See Demo